View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3227_low_10 (Length: 360)
Name: NF3227_low_10
Description: NF3227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3227_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 17 - 122
Target Start/End: Complemental strand, 48568026 - 48567921
Alignment:
| Q |
17 |
actctcttgaggctttcaaatatgcttggatatctctttcaaattaatcaattttgaatgacctaaaatgttaactatagacctgctcttaagtacttat |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568026 |
actctcttgaggctttcaaatatgctcggatatctctttcaaattaatcaattttgaatgacctaaaatgttaactatagacctgctcttaagtacttat |
48567927 |
T |
 |
| Q |
117 |
accttg |
122 |
Q |
| |
|
|||||| |
|
|
| T |
48567926 |
accttg |
48567921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 268 - 339
Target Start/End: Complemental strand, 48565444 - 48565373
Alignment:
| Q |
268 |
atagaataagcctttggtcatcatggttagactagactgtagaaatctcggaaattcactagcggtatttaa |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565444 |
atagaataagcctttggtcatcatggttagactagactgtagaaatctcggaaattcactagcggtatttaa |
48565373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 196 - 256
Target Start/End: Complemental strand, 48565548 - 48565488
Alignment:
| Q |
196 |
agagaaaaaagagggagattgcacacacttcaaatatgatgattcaatttcccatccctca |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48565548 |
agagaaaaaagagggagattgcacacacttcaaatatgatgattcaatttcccatacctca |
48565488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 118 - 148
Target Start/End: Complemental strand, 48565601 - 48565571
Alignment:
| Q |
118 |
ccttgtgaagagaggacgaaccagtgacata |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48565601 |
ccttgtgaagagaggacgaaccagtgacata |
48565571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University