View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3227_low_8 (Length: 390)
Name: NF3227_low_8
Description: NF3227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3227_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 19 - 382
Target Start/End: Original strand, 35042386 - 35042749
Alignment:
| Q |
19 |
gcactcacctgacttccatccaaaagaggagtgtcgttgacattatcagtacatctttctaacaacatgtttctgagatgggatacttccttcataaggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042386 |
gcactcacctgacttccatccaaaagaggagtgtcgttgacattatcagtacatctttctaacaacatgtttctgagatgggatacttccttcataaggt |
35042485 |
T |
|
| Q |
119 |
cttgggcaacctcttcggcatctagcagctgatttctagaaaattcaaatgctctttctgcatgaaggcgaaaagaaacacagttcaaacatgtgcaaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042486 |
cttgggcaacctcttcggcatctagcagctgatttctagaaaattcaaatgctctttctgcatgaaggcgaaaagaaacacagttcaaacatgtgcaaag |
35042585 |
T |
|
| Q |
219 |
ccctctgcatcctcttgggttttttctcaaaattccttttcgggaactaacggcaagggcatcatgttgatctgtgactttcattttggacaagctccga |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35042586 |
ccctctgcatcctcttgggttttttctcaaaattccttttcgggaactaacggcaagggcatcatgttgatctctgactttcattttggacaagctccga |
35042685 |
T |
|
| Q |
319 |
caacatccaggtgtttcaggtgatttctctccgttggacaaggcaggtgaacctacttcatctc |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35042686 |
caacatccaggtgtttcaggtgatttctctccgttggacaaggcaggtgaacctacttcttctc |
35042749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University