View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3227_low_9 (Length: 377)
Name: NF3227_low_9
Description: NF3227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3227_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 7 - 377
Target Start/End: Original strand, 44998402 - 44998772
Alignment:
| Q |
7 |
gagagaagaaggcggtgggaagcggaggagggagtacttgggaggtagctgtggtggaggagaggagaaagaggcagcaaataaggaggagaaggatgaa |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998402 |
gagagaaggaggcggtgggaagcggaggagggagtacttgggaggtagctgtggtggaggagaggagaaagaggcagcaaataaggaggagaaggatgaa |
44998501 |
T |
 |
| Q |
107 |
gatgaagggaaatggtgatcatggtgagaatgaagaaggagacgaggaggaagaagataacatcagtggtggcggtgagagacaaagagaacatccattc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998502 |
gatgaagggaaatggtgatcatggtgagaatgaagaaggagacgaggaggaagaagataacatcagtggtggcggtgagagacaaagagaacatccattc |
44998601 |
T |
 |
| Q |
207 |
attgtgacagagcctggggaagttgcacgtggcaaaaagaacggtctagattatctttttcatctctatgaacaatgtcgtgagttcttgattcaggatc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44998602 |
attgtgacagagcctggggaagttgcacgtggcaaaaagaacggtctagattatctttttcatctctatgaacaatgtcgtgagttcttgattcaggttc |
44998701 |
T |
 |
| Q |
307 |
aagccattgctaaggaacgcggtgagaaatgccctgccaaggtatactataccatgccctaacaacatttt |
377 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44998702 |
aagcaattgctaaggaacgcggtgagaaatgccctaccaaggtatactataccatgcccgaacaacatttt |
44998772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University