View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3228_high_10 (Length: 238)
Name: NF3228_high_10
Description: NF3228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3228_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 43764050 - 43763828
Alignment:
| Q |
1 |
agtcttaaagcctcggaggaaatccaaagttgtgaaatgtcttgatcgttccatcaagacctgctgcaacaactgatagtccccatgtttctggcacaca |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43764050 |
agtcttaaagcctcgcaggaaatccaaagttgtgaaatgtcttgatcgttccatcaagacctgctgcaacaactgatagtccccatgtttctggcacaca |
43763951 |
T |
|
| Q |
101 |
attgtcatggcatagattcttaagacatagctcttcatcctcagattcaacttctgaaagaggtgaatcccaactgggaagtttctcttcgggccatgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43763950 |
attgtcatggcatagattcttaagacatagctcttcatcctcagattcaacttctgaaagaggtgaatcccaactgggaagtttctcttcgggccatgtc |
43763851 |
T |
|
| Q |
201 |
atagaacctcggcatgaaccatc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43763850 |
atagaacctcggcatgaaccatc |
43763828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 21 - 87
Target Start/End: Complemental strand, 43764380 - 43764314
Alignment:
| Q |
21 |
aatccaaagttgtgaaatgtcttgatcgttccatcaagacctgctgcaacaactgatagtccccatg |
87 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
43764380 |
aatccaaagttgttaaatgtcttgatggttccatcaagaccagctgcaacaactgatagttcccatg |
43764314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 87
Target Start/End: Complemental strand, 43764240 - 43764157
Alignment:
| Q |
4 |
cttaaagcctcggaggaaatccaaagttgtgaaatgtcttgatcgttccatcaagacctgctgcaacaactgatagtccccatg |
87 |
Q |
| |
|
|||||||||| | || ||||||||||||||||||||||| | |||||||||| || ||||||||||||||| || |||||| |
|
|
| T |
43764240 |
cttaaagcctagcggggaatccaaagttgtgaaatgtctttacggttccatcaaaactagctgcaacaactgatggtacccatg |
43764157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University