View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3228_high_13 (Length: 227)
Name: NF3228_high_13
Description: NF3228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3228_high_13 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 50572812 - 50573038
Alignment:
| Q |
1 |
acaactgcacttatctctgcttctggcatgatggtatgctctttggttgcacttgctcattgaagtgctttatgnnnnnnnaacattgtattccaatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50572812 |
acaactgcacttatctctgcttctggcatgatggtatgctctttggttgcacttgctcattgaagtgctttatgtttttttaacattgtattccaatatt |
50572911 |
T |
 |
| Q |
101 |
gtatgtgttgtttaacatataaccatatccctaatcattgttccttttgcaaaaccaaataatttggcatagtactttgaaggaattctgtttcttatgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50572912 |
gtatgtgttgtttaacatataaccatatccctaatcagtgttccttttgcaaaaccaaataatttggcatagtactttgaaggaattctgtttcttatgc |
50573011 |
T |
 |
| Q |
201 |
tgttctaatttacctagatttgtattt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
50573012 |
tgttctaatttacctagatttgtattt |
50573038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 2 - 71
Target Start/End: Original strand, 50566973 - 50567042
Alignment:
| Q |
2 |
caactgcacttatctctgcttctggcatgatggtatgctctttggttgcacttgctcattgaagtgcttt |
71 |
Q |
| |
|
||||||||||||||| | ||||||| | |||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
50566973 |
caactgcacttatctattcttctgggaagatggtgtgctcttttgttgcaattgctcattgaagtgcttt |
50567042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University