View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3228_high_14 (Length: 227)
Name: NF3228_high_14
Description: NF3228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3228_high_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 27 - 227
Target Start/End: Complemental strand, 38075266 - 38075066
Alignment:
| Q |
27 |
gaatttccaaaccttgaggttggtggagctaatattgtactaatatagagtgtttccataatctaatttacgtgcttgtgttgttagtgtcacctactac |
126 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38075266 |
gaatttccaaaccttgaggttggtggaactaatattgtactaaaatagagtgtttccataatctaatttacgtgcttgtgttgttagtgtcacctactac |
38075167 |
T |
 |
| Q |
127 |
tacagtatgtcgtgagaggcattacttgcttagttaggactcaacggtcaacaactcccgatcatgactccgtagttggtgggtctgagatttgacaaaa |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38075166 |
tacagtatgtcgtgagaggcattacttgcttagttaggactcaacggtcaacaactcccgatcatgactccgtagttggtgggtctgagatttgacaaaa |
38075067 |
T |
 |
| Q |
227 |
a |
227 |
Q |
| |
|
| |
|
|
| T |
38075066 |
a |
38075066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University