View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3228_high_15 (Length: 225)
Name: NF3228_high_15
Description: NF3228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3228_high_15 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 30292695 - 30292471
Alignment:
| Q |
1 |
ttttttaaccacaaaattatattttaaaactagagaatttcataactttagtaaattactttacataacacaaaatattataaaattttatgggtgtctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30292695 |
ttttttaaccacaaaattatattttaaaactagagaatttcataactttagtaaattactttacataacacaaaatattataaaattttatgggtgtctt |
30292596 |
T |
 |
| Q |
101 |
aaaagaaatatagtttaaggacatatatccaccatttatacttgattaagttattcttactcattctgtagggaaaaatatcgttcgttcatactcatag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30292595 |
aaaagaaatatagtttaaggacatatatccaccatttatacttgattaagtcattcttactcattctgtagggaaaaatatctttcgttcatactcatag |
30292496 |
T |
 |
| Q |
201 |
tagcagagaggaggtggcacaaaac |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30292495 |
tagcagagaggaggtggcacaaaac |
30292471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 30287591 - 30287513
Alignment:
| Q |
106 |
aaatatagtttaaggacatatatccaccatttatacttgattaagttattcttactcattctgtagggaaaaatatcgttc |
186 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| |||||||||||||||| |||| ||| |||||||||||||| |||| |
|
|
| T |
30287591 |
aaatatactttaaggacatatatcctccatttatgcttgattaagttattc--actctttcagtagggaaaaatattgttc |
30287513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University