View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3228_high_16 (Length: 214)
Name: NF3228_high_16
Description: NF3228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3228_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 12 - 196
Target Start/End: Complemental strand, 39540764 - 39540580
Alignment:
| Q |
12 |
tgagaagaaggaattggaagagagaattgaatcagttcttgaacctaagatggaaggtttggaaaagattctttatagagctgatgatttaaggctgaga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39540764 |
tgagaagaaggaattggaagagagaattgaatcagttcttgaacctaaggtggaaggtttggaaaagattctttatagagctgatgatttaaggctgaga |
39540665 |
T |
 |
| Q |
112 |
gctttgcagggcattgtcaatattctgactccaaaacaagctattcacttcttgattgcagctgctgagctgcatttgaggctac |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39540664 |
gctttgcagggcattgtcaatattctgactccaaaacaagctattcacttcttgattgcagctgctgagctgcacttgaggctac |
39540580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University