View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3228_high_9 (Length: 240)
Name: NF3228_high_9
Description: NF3228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3228_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 50573255 - 50573477
Alignment:
| Q |
1 |
cggtatcatgcaaaagcttggttttccggctaaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaacaatttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50573255 |
cggtatcatgcaaaagcttggttttccggctaaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaacaatttgt |
50573354 |
T |
 |
| Q |
101 |
gnnnnnnnctcgtaatacttgattccttagcctttatttatgctttaggatttcaagattcgaagccatatgaatgtcaacttccgcagatggttggatg |
200 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
50573355 |
gtttttttctcgtaatacttgattcctttgcctttatttatgctttaggatttcaagattcgcagccagatgaatgtcaacttccgcaaatggttggatg |
50573454 |
T |
 |
| Q |
201 |
gtcttgcgtgttcctatggtgct |
223 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
50573455 |
gtcttgcgcgttcctatggtgct |
50573477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 160
Target Start/End: Original strand, 50562094 - 50562138
Alignment:
| Q |
116 |
tacttgattccttagcctttatttatgctttaggatttcaagatt |
160 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||||||| ||||| |
|
|
| T |
50562094 |
tacttgattccttcggctttacttatgctttaggatttccagatt |
50562138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 93
Target Start/End: Original strand, 50567427 - 50567514
Alignment:
| Q |
3 |
gtatcatgcaaaagcttggttttccggctaaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaac |
93 |
Q |
| |
|
||||||| |||||| ||||||||| | |||||| ||||||||| ||| |||||||| |||||| ||| ||| ||||||||||||||| |
|
|
| T |
50567427 |
gtatcatacaaaagtgtggttttcccgtcaaatttaaggtacaacatctactctttcatattatc---ttcgctgaaattgtttcatcaac |
50567514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University