View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3228_low_19 (Length: 214)

Name: NF3228_low_19
Description: NF3228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3228_low_19
NF3228_low_19
[»] chr8 (1 HSPs)
chr8 (12-196)||(39540580-39540764)


Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 12 - 196
Target Start/End: Complemental strand, 39540764 - 39540580
Alignment:
12 tgagaagaaggaattggaagagagaattgaatcagttcttgaacctaagatggaaggtttggaaaagattctttatagagctgatgatttaaggctgaga 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
39540764 tgagaagaaggaattggaagagagaattgaatcagttcttgaacctaaggtggaaggtttggaaaagattctttatagagctgatgatttaaggctgaga 39540665  T
112 gctttgcagggcattgtcaatattctgactccaaaacaagctattcacttcttgattgcagctgctgagctgcatttgaggctac 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
39540664 gctttgcagggcattgtcaatattctgactccaaaacaagctattcacttcttgattgcagctgctgagctgcacttgaggctac 39540580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University