View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3228_low_7 (Length: 296)
Name: NF3228_low_7
Description: NF3228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3228_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 273
Target Start/End: Complemental strand, 32194727 - 32194455
Alignment:
| Q |
1 |
tcacggttatgtccaatgcaactcagatgttgctatagtttctgcccaaaatggagttggtatgggagcatgtgtgcatgatagtgcatgccgtttaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32194727 |
tcacggttatgtccaatgcaactcagatgttgctatagtttctgcccaaaacggagttggtatgggagcatgtgtgcatgatagtgcaggccgtttaaca |
32194628 |
T |
 |
| Q |
101 |
ccagcatactctatgtggattccttcaactatgacggcggtggaaggggaagcgtgggggctgttgcaatctctcaagtggcttgtgtccatgaatcttg |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32194627 |
ccagcaaactctatgtggattccttcaactatgacggcggtggaaggggaagcatgggggctgttgcaatctctcaagtggcttgtgtccttgaatcttg |
32194528 |
T |
 |
| Q |
201 |
aatttattgaattggaaagtaagcaagttgtgactgatatctacaatgttaaaactgatttatctgagtatgg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32194527 |
aatttattgaattggaaagtaagcaagttgtgactgatatctacaatgttaaaactgatttatctgagtatgg |
32194455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 155 - 273
Target Start/End: Complemental strand, 32185928 - 32185808
Alignment:
| Q |
155 |
tgggggctgttgcaatctctcaagtggcttgtgtccatgaatcttgaatttattgaattggaaagtaagcaagttgtgactgatatctacaa----tgtt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||||||| ||||| | || |||||| ||| |||||| || | |
|
|
| T |
32185928 |
tgggggctgttgcaatctctcaagtggcttatgtccatgaatcatgactttattgaattggacagtaa--atgtggtgactaatacctacaattattgct |
32185831 |
T |
 |
| Q |
251 |
aaaactgatttatctgagtatgg |
273 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32185830 |
aaaactgatttatctgagtatgg |
32185808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 149 - 216
Target Start/End: Complemental strand, 32186870 - 32186803
Alignment:
| Q |
149 |
gaagcgtgggggctgttgcaatctctcaagtggcttgtgtccatgaatcttgaatttattgaattgga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
32186870 |
gaagcgtgggggctgttgcaatctctcaagtggcttatgtcaatgaatcttgactttattgaattgga |
32186803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University