View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3228_low_9 (Length: 254)
Name: NF3228_low_9
Description: NF3228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3228_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 43538006 - 43538247
Alignment:
| Q |
1 |
aaaactttcattgaattcagattcttcttctgaaccatttagaattctgttggcttctatagaaaaaccaatggcacgccaagcatctgcgaccagctcg |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43538006 |
aaaactttcatcgaattcagattcttcttctgaaccatttagaattctgttggcttctttagaaaaaccaatggcacgccaagcatctgc-accagctcg |
43538104 |
T |
 |
| Q |
101 |
atggtggacatttcaggagctacaccactttcttccatagtaacaagtaactcttctgctttccacggttgttttgcttctccatatccccatattaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43538105 |
atggtggacatttcaggagctacaccactttcttccatagtaacaagtaactcttctgctttccacggttgttttgcttctccatatccccatattaaag |
43538204 |
T |
 |
| Q |
201 |
tttcatatgttttcaaattcaagggagttcccatttcgttcat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43538205 |
tttcatatgttttcaaattcaagggagttcccatttcgttcat |
43538247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University