View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_108 (Length: 259)
Name: NF3229_high_108
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_108 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 10 - 183
Target Start/End: Original strand, 40576600 - 40576774
Alignment:
| Q |
10 |
ttaaaaaatattaatgttaatatgagtacttttttgtgaaatgcaggaccaatatatattacatactgctgagtctcagaatattacccttccattcgcc |
109 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40576600 |
ttaaaaaatattaatgttaatgtgagtactgttttgtgaaatgcaggaccaatatatattacatactgctgagtctcagaatattacccttccattcgcc |
40576699 |
T |
 |
| Q |
110 |
tgcaggcatggtacttacttttatcttcaaattatgactgtatcttgatta-tttaaacttatgcaaatcatcat |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40576700 |
tgcaggcatggtacttacttttatcttcaaattatgagtgtatcttgattattttaaacttatgcaaatcatcat |
40576774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University