View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_124 (Length: 249)
Name: NF3229_high_124
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_124 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 13487800 - 13488018
Alignment:
| Q |
18 |
attattagggtaaatttttctacattaccaacctatgaatcacaaacacggaccctggttccgacactaacactaacatgttgacacagataataatttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
13487800 |
attattagggtaaatttttctacattaccaacctatgaatcacaaacacggaccctggttccgacactgacactaacatgttgacaccgataataatttg |
13487899 |
T |
 |
| Q |
118 |
aaatgtcgtaattgaatgtaattacacgtgttagacaccggagatgtctttgttcagaagtgccggtgctaaaagtaattgtgattaaagtcaaaca-tt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13487900 |
aaatgtcgtaattgaatgtaattacacgtgttagacaccggagatgcctttgttcagaagtgccggtgctaaaagtaattgtgattaaagtcaaacattt |
13487999 |
T |
 |
| Q |
217 |
tttatgatttgatgattat |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13488000 |
tttatgatttgatgattat |
13488018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University