View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_126 (Length: 249)
Name: NF3229_high_126
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_126 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 43240112 - 43240348
Alignment:
| Q |
1 |
atataaatgattggatcaattaattaaatgagtaattttttatataaa-gtggttgttttttgtgataggaaatcaacgcagaatttagtgattctcctt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43240112 |
atataaatgattggatcaattaattaaatgagtaattttttatataaaagtggttgttttttgtgataggaaatcaacgcagaatttagtgattctcctt |
43240211 |
T |
 |
| Q |
100 |
ggagacttcaatactacatagtagtaacaggagctgcatacttcattttttccttctccattccaacattatcttctatgagaaattggctaggagcttc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43240212 |
ggagacttcaatactacatagtagtaacaggagcagcatacttcattttttccttctccattccaacattatcttctatgagaaattggctaggagcttc |
43240311 |
T |
 |
| Q |
200 |
agctgttgtcaccctagcatacatagcatttcttgtc |
236 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43240312 |
agctgttgtcactctagcatacatagcatttcttgtc |
43240348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University