View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_129 (Length: 248)
Name: NF3229_high_129
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_129 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 233
Target Start/End: Complemental strand, 40576819 - 40576603
Alignment:
| Q |
16 |
atttcaaacatgtcaatgtctttctgtccatgttttatatgtaattagtgacatgtataagttatttttgtatggattatattcaaattgaaagcaattg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40576819 |
atttcaaacatgtcaatgtctttctgtccatgttttatatgtaattagtgacatgtataagttatttttgtatggattatattcaaattgaaagcaattg |
40576720 |
T |
 |
| Q |
116 |
caagtgaagaataaatataaa-atgggacagatgtatgagactcgatcgtaattaatcataaggtgcacggttcaccatatagattcaatgtttcctttt |
214 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40576719 |
caagtgaagaataaatataaatatgggacagatgtatgagactcgatcgtaattaatcataaggtgcacggttcacc--atagattcaatgtttcctttt |
40576622 |
T |
 |
| Q |
215 |
ttgtttgttagtattttca |
233 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40576621 |
ttgtttgttagtattttca |
40576603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University