View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_135 (Length: 246)
Name: NF3229_high_135
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_135 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 66 - 238
Target Start/End: Complemental strand, 40576591 - 40576419
Alignment:
| Q |
66 |
agttaattcagttgagtagatgattaattcatacctcgggtacgaggaattcgtgaacaactcctcgttgtctatcgtgaactgtgaccttatgagttgg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40576591 |
agttaattcagttgagtagatgattaattcaaacctcgggtacgaggaattcgtgaacaactcctcgttgtctatcgtgaactgtgaccttatgcgttgg |
40576492 |
T |
|
| Q |
166 |
agcatcaccactcggataccggtaatcgtttgcttcagttagtctaaccggcgtttgaagctccgtctctgct |
238 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
40576491 |
agcatcgccactaggataccggtaatcgtttgcttcagttagtctcaccggcgtttgaagctccgtcgctgct |
40576419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University