View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3229_high_140 (Length: 242)

Name: NF3229_high_140
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3229_high_140
NF3229_high_140
[»] chr4 (1 HSPs)
chr4 (20-235)||(54423722-54423937)
[»] chr1 (2 HSPs)
chr1 (94-223)||(20120923-20121052)
chr1 (20-91)||(20127324-20127395)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 20 - 235
Target Start/End: Original strand, 54423722 - 54423937
Alignment:
20 ttgttttgtagcgcatatgatggagaactttgaatgatgttagcgcattgtccatgattgagtgagaatgcatgaaggctgtttgttcttgggaaatcca 119  Q
    |||||||| ||||||||||||| ||||||| ||||| |||||||||||| |||||||||||| |||||||||  |||||||  |||||||||||||||||    
54423722 ttgttttgcagcgcatatgatgaagaacttcgaatgctgttagcgcattatccatgattgagcgagaatgcacaaaggctgcctgttcttgggaaatcca 54423821  T
120 tttgttaattagtggagggagacgattggaaaggaccataaagacaatcttgtataatacattgcagagagaaataggccgaaggtctcgcatggattcc 219  Q
    ||||||||| |||||| | |||||||||   |||||| || | || ||||||||||| |||||||||||||||||||| |||||||| ||||||||||||    
54423822 tttgttaataagtggacgaagacgattgaccaggaccttagaaacgatcttgtataacacattgcagagagaaataggtcgaaggtcccgcatggattcc 54423921  T
220 ggataatcaccctttg 235  Q
     ||| |||||||||||    
54423922 agattatcaccctttg 54423937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 94 - 223
Target Start/End: Complemental strand, 20121052 - 20120923
Alignment:
94 aaggctgtttgttcttgggaaatccatttgttaattagtggagggagacgattggaaaggaccataaagacaatcttgtataatacattgcagagagaaa 193  Q
    ||||||| |||||||||||||||||||||||| |||| |||| |||||||||||| ||||||| || ||||||||||||| | |||||| ||||||||||    
20121052 aaggctgcttgttcttgggaaatccatttgttgattaatggatggagacgattggcaaggaccttagagacaatcttgtacagtacattacagagagaaa 20120953  T
194 taggccgaaggtctcgcatggattccggat 223  Q
    ||||||||||||||||||||||||||||||    
20120952 taggccgaaggtctcgcatggattccggat 20120923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 91
Target Start/End: Complemental strand, 20127395 - 20127324
Alignment:
20 ttgttttgtagcgcatatgatggagaactttgaatgatgttagcgcattgtccatgattgagtgagaatgca 91  Q
    |||||||| |||||||||||||||| ||||  || |  ||||||||||| |||||||||||| |||||||||    
20127395 ttgttttgcagcgcatatgatggaggacttcaaaagcggttagcgcattatccatgattgagcgagaatgca 20127324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University