View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_148 (Length: 239)
Name: NF3229_high_148
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_148 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 28430113 - 28429881
Alignment:
| Q |
1 |
tggtgggtttgctgaaatcgaagtgagtcaccatgattctgcaaaggctacactatgtaacttttgaaaaattatgttgactcactctgattctgacaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
28430113 |
tggtgggtttgctgaaatcgaagtgagccaccatgattctgcaaaggctacactatgtagcttttgaaaaattatgctgactcactctgatttcgacaaa |
28430014 |
T |
|
| Q |
101 |
caccattcgttactaaacaaacacatgatattatcattatcactcaccaactgatcacatcttaaataattcatcaattttatttccacattgcgaattg |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28430013 |
caccattcgttactaaataaacacatgatattatcattatcactcaccaactgatcacatcttaaataattcatcaattttatttccacattgcgaattg |
28429914 |
T |
|
| Q |
201 |
gaagaaaatacaaaacattgatgaatgtaacat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28429913 |
gaagaaaatacaaaacattgatgaatgtaacat |
28429881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University