View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3229_high_152 (Length: 237)

Name: NF3229_high_152
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3229_high_152
NF3229_high_152
[»] chr7 (2 HSPs)
chr7 (110-221)||(46971197-46971308)
chr7 (2-46)||(46971358-46971403)


Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 110 - 221
Target Start/End: Complemental strand, 46971308 - 46971197
Alignment:
110 atgatgaaattaatctttgtaacatgtacaacatttaatttaacccactccaaaataaactacataaagacttaaaataaatattacacgtatattatac 209  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
46971308 atgatgaaattaatctttgtaacatgtacaacatttaatttaactcactccaaaatcaactacataaagacttaaaataaatattacacgtatattatac 46971209  T
210 accagttataat 221  Q
    ||||||||||||    
46971208 accagttataat 46971197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 46971403 - 46971358
Alignment:
2 ccaaaattaaaatgtatgatata-tcaataaactacatgacaaaaa 46  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||    
46971403 ccaaaattaaaatgtatgatataatcaataaactacatgacaaaaa 46971358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University