View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_156 (Length: 237)
Name: NF3229_high_156
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_156 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 44525832 - 44525616
Alignment:
| Q |
1 |
tcaaagttacattaacattttttgtcaaataattggaagggttcaaaaatttatttggaagctttatcatagtaaacttcttataacgtaagaaacgtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||| ||| |
|
|
| T |
44525832 |
tcaaagttacattaacattttttgtcaaataattggaagggttcaaaaatttatttggaagctttatcatggtaagcttcttataatgtaagaaacatca |
44525733 |
T |
|
| Q |
101 |
aagtatctatgatttggatacttgcttcagatgtttctgagaaccagaaatcatatgatgcatgtttttgcgagg-ttgtaatgtagctaaggagctatg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44525732 |
aagtatctatgatttggatacttgcttcagatgtttctgagaaccagaaatcatatgatgcatgtttttgcgaggtttgtaatgtagctaaggagctatg |
44525633 |
T |
|
| Q |
200 |
gaaaaactttattacgt |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44525632 |
gaaaaactttattacgt |
44525616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University