View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_162 (Length: 235)
Name: NF3229_high_162
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_162 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 109 - 223
Target Start/End: Complemental strand, 40054999 - 40054885
Alignment:
| Q |
109 |
gtgcacaaacaagaacacttgttacttatccaagaacatttggatgtggtataatagatttctctcaattgaagtaaagattttaggtttgaattcaact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
40054999 |
gtgcacaaacaagaacacttgttacttatccaagaacatttggatgtgatataatagatttctctcaatttaactaaagattttaggtttgaattcaact |
40054900 |
T |
 |
| Q |
209 |
ctgaaaatgtagctg |
223 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40054899 |
ctgaaaatgtagctg |
40054885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 40055107 - 40055046
Alignment:
| Q |
1 |
aaacttgttctgaccgagccaatgttcagtgcacaaacaagaattaaacaagatattagttc |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40055107 |
aaacttgttctgaccgagccaatgttcagtgcacaaacaagaattaaacaagatattagttc |
40055046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University