View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_167 (Length: 228)
Name: NF3229_high_167
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_167 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 14821058 - 14820829
Alignment:
| Q |
1 |
tgtaactaaaatatgattggagagattggacttattttgctttgcccctctgcatgaaaatggtgctgaataagagtaacat--gtgtgtgcctaaacat |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14821058 |
tgtaactaaaatatgattggagagattggacttattttgctttgcccctctgcatgaaaatggtgctgaataagagtaacatatgtgtgtgcctaaacat |
14820959 |
T |
 |
| Q |
99 |
acaagggaatgaaaatgaatttgaagggagcatatatgcaaagcacacatgaaaaggataaagaaagcgaaatgtgagttaatagcagcattgggtttgt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14820958 |
acaagggaatgaaaatgaatttgaagggagcatatatgcaaagcacacatgaaaaggataaagaaagcgaaatgtgagttaatagcagcattgggtttgt |
14820859 |
T |
 |
| Q |
199 |
tattgacactactttcttatctctatattt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14820858 |
tattgacactactttcttatctctatattt |
14820829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University