View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3229_high_185 (Length: 211)

Name: NF3229_high_185
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3229_high_185
NF3229_high_185
[»] chr1 (1 HSPs)
chr1 (1-88)||(38635278-38635365)


Alignment Details
Target: chr1 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 38635278 - 38635365
Alignment:
1 caaccgtcgtcataggccctttttcaacaacttcatcttcgaatcgcaatgctagaaccacattttccgccaattttacttctagaag 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
38635278 caaccgtcgtcataggccctttttcaacaacttcatcttcgaatcgcaatgctagaaccacatttgccgccaattttacttctagaag 38635365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University