View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_186 (Length: 209)
Name: NF3229_high_186
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_186 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 194
Target Start/End: Original strand, 34288516 - 34288695
Alignment:
| Q |
16 |
agagaccgactattataggaatatatcgaaagaaattgcacacaggatttttctgcattgcc-atgcctaatggcattgttcagctatatacgttgtggc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34288516 |
agagaccgactattataggaatatatcgaaagaaattgcacacaggatttttctgcattgcccatgcctaatggcattgttcagctatatacgttgtggc |
34288615 |
T |
 |
| Q |
115 |
tatgctacgaatttatgcaagcaaatgctacattacttgtttcaatcaattcatttggatgcttcattgagtctatatat |
194 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34288616 |
tatgctacgaattgatgcaagcaaatgctacattacttgtttcaatcaattcatttggatgcttcattgagtctatatat |
34288695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University