View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_25 (Length: 431)
Name: NF3229_high_25
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 2e-44; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 324 - 426
Target Start/End: Complemental strand, 6515837 - 6515734
Alignment:
| Q |
324 |
actatgtaacggttgcagaggatcctaatctactggtgttttccgcttctttaacaatggtttgtttgcatttttccttgtgacgtg-tggtccctttgt |
422 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
6515837 |
actatgtaacggttgcagaggatcctaatctactggtgttttccgcttctttaacaatggtttgtttgcatttttccttgtgacgtgttggtcccttagt |
6515738 |
T |
|
| Q |
423 |
ttct |
426 |
Q |
| |
|
|||| |
|
|
| T |
6515737 |
ttct |
6515734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 15 - 87
Target Start/End: Complemental strand, 6516468 - 6516397
Alignment:
| Q |
15 |
tttctctgtggtctatgttttgcatttgccccctaagcaagcaattagcgtttcacttagatatgtgtatcac |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6516468 |
tttctctgtggtctatgttttgcatttgcccc-taagcaagcaattagcgtttcacttagatatgtgtatcac |
6516397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 281 - 325
Target Start/End: Complemental strand, 6515970 - 6515926
Alignment:
| Q |
281 |
ttttgtgtttgatttctatgttgttgggtatggatcatctgcaac |
325 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6515970 |
ttttttgtttgatttctatgttgttgggtatggatcatctgcaac |
6515926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University