View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_37 (Length: 407)
Name: NF3229_high_37
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 7 - 397
Target Start/End: Original strand, 33739008 - 33739403
Alignment:
| Q |
7 |
gtttcaataaaagtaaaaagggttttagatttagtagcaaatttagggagatcatgtacaagatttaatctttcaaattcaatggttaattgttaatatt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33739008 |
gtttcaataaaagtaaaaagggttttagatttagtcgaaaatttagggagatcatgtacaagatttaaactttcaaattcaatggttaattgttaatatt |
33739107 |
T |
 |
| Q |
107 |
tatattgtcgtccttatagc--ataaataatgaaacaggctacggagttttgcttttgatctc-------ttatgtagttcgacgctatcttggcgcata |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33739108 |
tatattgtcgtccttatagcatataaataatgaaacaggctacggagttttgcttttgatctctacagggttatgtagttcgacgctatcttggcgcata |
33739207 |
T |
 |
| Q |
198 |
tttgatgaagttacannnnnnnnnnnngaatcagcaaaagtttttcaaagcatagtccgtgcaagacgcacaacaataatcataattaatttggttaatt |
297 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
33739208 |
tttgatgaagttacattttttctttttgaatcagcaaaagtttttcaaagcatagcccgtgcaagacgcacaacgataatcacaattaatttggttaatt |
33739307 |
T |
 |
| Q |
298 |
taattggtttaatatttatattgtcatccttataacataaataaggaaacatgcatccagcctacaggcgttttgcgcttgatctctgcaagggtctgtg |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33739308 |
taattggtttaatatttatattgtcatccttataacataaataaggaaacatg----cagcctacaggcgttttgcgcttgatctctgcaagggtgtgtg |
33739403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University