View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_41 (Length: 395)
Name: NF3229_high_41
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 7e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 3031294 - 3031139
Alignment:
| Q |
1 |
tcgctttgctagtccatagtcctcttccagcttagcatattgcagatagagagggttcacttgatcagctggggcctgttttggcaagcattatcc--ag |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
3031294 |
tcgctttgctagtccatagtcctcttccagcttagcatattgcagatagagaggtttcacttgatcagctggggcctgttttggcaagcattttccaaaa |
3031195 |
T |
 |
| Q |
99 |
agcaaattgtgttagcattataacacgttatcaacaataaaattcaagtgctacaa |
154 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
3031194 |
agcaaatagtgttagcattataatacgttatcaacaataaaattcaagtgttacaa |
3031139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 2 - 82
Target Start/End: Original strand, 12014967 - 12015046
Alignment:
| Q |
2 |
cgctttgctagtccatagtcctcttccagcttagcatattgcagatagagagggttcacttgatcagctggggcctgtttt |
82 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| ||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12014967 |
cgctttgccagtccatagttctcttccagcttt-catattgtagatagagaggtttcacttgatcagctggggcctgtttt |
12015046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University