View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_58 (Length: 357)
Name: NF3229_high_58
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_58 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 258 - 346
Target Start/End: Original strand, 7927831 - 7927918
Alignment:
| Q |
258 |
atttgaaacatctctttgcaaattattatgggttgtannnnnnnnaaacataaaaataaaagcaagttaagatgaaaagttgttagtga |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7927831 |
atttgaaacatctctttgcaaattattatgggttgta-tttttttaaacatcaaaataaaagtaagttaagatgaaaagttgttagtga |
7927918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 27351221 - 27351179
Alignment:
| Q |
1 |
ttagacttaaatttattttttgaggctcatagcatttggaggc |
43 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
27351221 |
ttagacttaaatttattttttgaggcccataacatttggaggc |
27351179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 3575249 - 3575324
Alignment:
| Q |
1 |
ttagacttaaatttattttttgaggctcatagcatttggaggcccgcctcagttgaataccttgcactccccaagg |
76 |
Q |
| |
|
|||||||||||||||||| ||||| | ||||||||||| | |||| || | |||| |||||||||||||||||| |
|
|
| T |
3575249 |
ttagacttaaatttatttgttgagtcccatagcatttgaatgcccaacttaattgaggaccttgcactccccaagg |
3575324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University