View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3229_high_66 (Length: 335)

Name: NF3229_high_66
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3229_high_66
NF3229_high_66
[»] chr4 (1 HSPs)
chr4 (7-317)||(51914490-51914800)
[»] chr2 (1 HSPs)
chr2 (76-134)||(18383298-18383356)


Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 7 - 317
Target Start/End: Complemental strand, 51914800 - 51914490
Alignment:
7 ggagcagagactttggatcgggattttccggcttacgctactctcggaaacggaaaacgtttctccggcgtttcactttacagtggagaaggaatgggaa 106  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51914800 ggagcagggactttggatcgggattttccggcttacgctactctcggaaacggaaaacgtttctccggcgtttcactttacagtggagaaggaatgggaa 51914701  T
107 acgaaccggttggtttggtttattttaacgaacggtttaattcatcgagtagtatatgtatgcccggttcacttgactctgaaatcgtgcgcgggaaagt 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51914700 acgaaccggttggtttggtttattttaacgaacggtttaattcatcgagtagtatatgtatgcccggttcacttgactctgaaatcgtgcgcgggaaagt 51914601  T
207 ggttgtttgtgataggggtgtaaattcacgtgtggagaaaggcacggttgtgattgacgccggaggtgttgggatgattcttgcaaacacggcggcgagc 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51914600 ggttgtttgtgataggggtgtaaattcacgtgtggagaaaggcacggttgtgattgacgccggaggtgttgggatgattcttgcaaacacggcggcgagc 51914501  T
307 ggtgaaggagt 317  Q
    |||||||||||    
51914500 ggtgaaggagt 51914490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 134
Target Start/End: Original strand, 18383298 - 18383356
Alignment:
76 gtttcactttacagtggagaaggaatgggaaacgaaccggttggtttggtttattttaa 134  Q
    |||||||||||||||||  |||||||||||||  |||||||| ||||||||||||||||    
18383298 gtttcactttacagtgggaaaggaatgggaaataaaccggttagtttggtttattttaa 18383356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University