View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_high_92 (Length: 286)
Name: NF3229_high_92
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_high_92 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 278
Target Start/End: Complemental strand, 10323248 - 10322988
Alignment:
| Q |
18 |
ctagaaatgcgaaaaatcatcaacaatttggctagagattgtaaggatattgtggatgaaatcaagatgttgtcatggtaatgaagtctttgccatttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10323248 |
ctagaaatgcgaaaaatcatcaacaatttggctagagattgtaaggatattgtggatgaaatcaagatgttgtcatggtaatgaagtctttgccatttaa |
10323149 |
T |
 |
| Q |
118 |
aggggagcccttgataagctcaaggagtccagctgaagcagataagtggtccgtctggatgtcgtttttccagttctgctactgtgcggttattgtttcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10323148 |
aggggagcccttgataagctcaaggagtccagctgaagcagataagtggtccgtctggatgtcatttttccagttctgctactgtgcggttattgtttcc |
10323049 |
T |
 |
| Q |
218 |
tttcctgttttaattcttgtggtcacactaggtattctaaactcacaaacttttctctgct |
278 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10323048 |
tttcctgttttaattcttgtagtctcactaggtactctaaactcacaaacttttctctgct |
10322988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 37 - 130
Target Start/End: Complemental strand, 24524777 - 24524684
Alignment:
| Q |
37 |
tcaacaatttggctagagattgtaaggatattgtggatgaaatcaagatgttgtcatggtaatgaagtctttgccatttaaaggggagcccttg |
130 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| |||||| |||| || | | |||| |||||| || ||||||||||||||||| |
|
|
| T |
24524777 |
tcaagaatttggctagagattgtgaggatattgtggatgagatcaaggtgttatctttgaaatggagtcttacccgcttaaaggggagcccttg |
24524684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 140 - 187
Target Start/End: Complemental strand, 24524640 - 24524593
Alignment:
| Q |
140 |
aggagtccagctgaagcagataagtggtccgtctggatgtcgtttttc |
187 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||||| |||||| |
|
|
| T |
24524640 |
aggagtccagctgcagcagatcagtggtccgtctggatgtcttttttc |
24524593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 37 - 130
Target Start/End: Complemental strand, 9130923 - 9130830
Alignment:
| Q |
37 |
tcaacaatttggctagagattgtaaggatattgtggatgaaatcaagatgttgtcatggtaatgaagtctttgccatttaaaggggagcccttg |
130 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| |||||| |||| || | | |||| |||||| || ||||||||||||||||| |
|
|
| T |
9130923 |
tcaagaatttggctagagattgtgaggatattgtggatgagatcaaggtgttatctttgaaatggagtcttacccgcttaaaggggagcccttg |
9130830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 187
Target Start/End: Complemental strand, 9122690 - 9122643
Alignment:
| Q |
140 |
aggagtccagctgaagcagataagtggtccgtctggatgtcgtttttc |
187 |
Q |
| |
|
||||||| ||||| ||||||| ||||||||||||||||||| |||||| |
|
|
| T |
9122690 |
aggagtcgagctgcagcagatcagtggtccgtctggatgtcttttttc |
9122643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 187
Target Start/End: Complemental strand, 9130786 - 9130739
Alignment:
| Q |
140 |
aggagtccagctgaagcagataagtggtccgtctggatgtcgtttttc |
187 |
Q |
| |
|
||||||| ||||| ||||||| ||||||||||||||||||| |||||| |
|
|
| T |
9130786 |
aggagtctagctgcagcagatcagtggtccgtctggatgtcttttttc |
9130739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University