View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_108 (Length: 264)
Name: NF3229_low_108
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_108 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 253
Target Start/End: Complemental strand, 34885460 - 34885227
Alignment:
| Q |
20 |
gattccaacgccatcaaagtcctcaacactcaaacgctccaagtcggttacatcgaacgctccgtcgcctccgctctcgctcctctcctcgacgctcaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34885460 |
gattccaacgccatcaaagtcctcaacactcaaacgctccaagtcggttacatcgaacgcgccgttgcctccgctctcgctcctctcctcgacgctcaca |
34885361 |
T |
|
| Q |
120 |
tcatccacgtcgaagccatcgttcaaccccgctctaacaataacaaattccgtatcccttgtcagattcatatcttcgctcatcaatcttcttttgatgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34885360 |
tcatccacgtcgaagccatcgttcaaccccgctctaacaataacaaattccgtatcccttgtcagattcatatcttcgctcatcaatcttcttttgatgc |
34885261 |
T |
|
| Q |
220 |
tgttcatgacgcttttaacggttccaatgttcat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34885260 |
tgttcatgacgcttttaacggttccaatgttcat |
34885227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University