View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_115 (Length: 254)
Name: NF3229_low_115
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_115 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 27780981 - 27781226
Alignment:
| Q |
1 |
tcaagctcttactatttctctcttatataaaacccataacttcgacagaaaataacgttcatcttttgatgagaacgccaatgttaaaatgtgattttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27780981 |
tcaagctcttactatttctctcttatataaaacccataacttcgacagaaaataaggtgcatcttttgatgagaacgccaatgttaaaatgtgattttca |
27781080 |
T |
 |
| Q |
101 |
ttcctaatcttgactccatgcaacaaggttaaaatcaatttaaaccttttgaatgtttggacttgtacacagggggatctctgcctctttttgattnnnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27781081 |
ttcctaatcttgactccatgcaacaaggttaaaatcaatttaaaccttttgaatgtttggacttatacacagggggatctctgcctctttttgattaaaa |
27781180 |
T |
 |
| Q |
201 |
nnntacatgcttcttctaattatattaatttcaaactctctctgct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27781181 |
aaatacatgcttcttctaattatattaatttcaaactctctatgct |
27781226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University