View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_116 (Length: 253)
Name: NF3229_low_116
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_116 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 34741776 - 34741547
Alignment:
| Q |
17 |
acaagtaatatagtaacaccaagaatttttcagaacttattacacttgacacaattttgatcacacataatatctttagtttatatcctagaccacatag |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34741776 |
acaagtaatatagtaacaccaagagtttttcagaacttattacacttgacacaattttgatcacacataatatcttcagtttatatcctagaccacatag |
34741677 |
T |
|
| Q |
117 |
gtatgcagtcacacaacaatcttcattcaattcttaacaactggaggaactgtcaatctctacacaaatgtaagtaagatgcatcaatgagattctttac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34741676 |
gtatgcagtcacacaacaatcttcattcaattcttaacaactggaggaactgtcaatctctacagaaatgtaagtaagatgcatcaatgagattctttac |
34741577 |
T |
|
| Q |
217 |
atataacttataagcagatttaattgtaaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34741576 |
atataacttataagcagatttaattgtaaa |
34741547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University