View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_123 (Length: 251)
Name: NF3229_low_123
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_123 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 249
Target Start/End: Complemental strand, 40055580 - 40055341
Alignment:
| Q |
11 |
cagagataattaaggttttatgatgacgtatacattttctcttaaaaa-cttaatatcttgaaataaatcttatattaatcctatatttggtatacaatt |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| || |||||| |||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40055580 |
cagaaataattaaggttttatgatgacgtatacattttctcttaaaaaactcaatatcctgaagtaaatcttatattaaacctatatttggtatacaatt |
40055481 |
T |
 |
| Q |
110 |
gcggtgatccatcttaattttataaaaactacattttatgacttcttcaaaattatgatggataactgtcaatgtgacatatcgatttagatgatgatat |
209 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40055480 |
gtggtgatccatcttaattttataaaaactacattttatgacttcttcaaaattatgatggataactgtcaatgtgacatatcgatttagatcatgatat |
40055381 |
T |
 |
| Q |
210 |
caaacacacgctaaaactcttttcaaaaaggaaattaact |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40055380 |
caaacacacgctaaaactcttttcaaaaaggaaattaact |
40055341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 113 - 162
Target Start/End: Complemental strand, 28307907 - 28307858
Alignment:
| Q |
113 |
gtgatccatcttaattttataaaaactacattttatgacttcttcaaaat |
162 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||||| |||||| |||||| |
|
|
| T |
28307907 |
gtgatccatcgtgattttttaaaaactacattttataacttctacaaaat |
28307858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University