View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_138 (Length: 246)
Name: NF3229_low_138
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_138 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 40333063 - 40332845
Alignment:
| Q |
1 |
gtggctctcgtgtgctgactttatcgtactgtatagcagcgctctctttgtatttcacacttttttaacaatgaaataatatgattatgtttaaaaagtg |
100 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40333063 |
gtggctctcgtgtgctgactttgtcgtgctgtatagcagtgctatctttgtatttcacacttttttaacaatgaaataatatgattatgtttaaaaagtg |
40332964 |
T |
|
| Q |
101 |
aatatgatggcattccatgaacctttttaatccaaatggtaaagttgtctctaatgatttactctcccactgaaatacatacatggaaattccagtaaga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40332963 |
aatatgatggcattccatgaacctttttaatccaaatggta-----------aataatttactctcccactgaaatacatacatgaaaattccagtaaga |
40332875 |
T |
|
| Q |
201 |
aacttaattagcattactgggagtcaaatc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40332874 |
aacttaattagcattactgggagtcaaatc |
40332845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 112 - 179
Target Start/End: Complemental strand, 40312998 - 40312931
Alignment:
| Q |
112 |
attccatgaacctttttaatccaaatggtaaagttgtctctaatgatttactctcccactgaaataca |
179 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| |||| || |||||||| |||||||||||||||||| |
|
|
| T |
40312998 |
attccaagaacctttttaatccaaacggtaaggttgattcgaatgattttctctcccactgaaataca |
40312931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 112 - 179
Target Start/End: Complemental strand, 40323074 - 40323007
Alignment:
| Q |
112 |
attccatgaacctttttaatccaaatggtaaagttgtctctaatgatttactctcccactgaaataca |
179 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| |||| || |||||||| |||||||||||||||||| |
|
|
| T |
40323074 |
attccaagaacctttttaatccaaacggtaaggttgattcgaatgattttctctcccactgaaataca |
40323007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 13066842 - 13066886
Alignment:
| Q |
1 |
gtggctctcgtgtgctgactttatcgtactgtatagcagcgctct |
45 |
Q |
| |
|
|||||||||||||||||||||| || | ||||||||||| ||||| |
|
|
| T |
13066842 |
gtggctctcgtgtgctgactttgtcatgctgtatagcagtgctct |
13066886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University