View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_145 (Length: 242)
Name: NF3229_low_145
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_145 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 20 - 235
Target Start/End: Original strand, 54423722 - 54423937
Alignment:
| Q |
20 |
ttgttttgtagcgcatatgatggagaactttgaatgatgttagcgcattgtccatgattgagtgagaatgcatgaaggctgtttgttcttgggaaatcca |
119 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| ||||| |||||||||||| |||||||||||| ||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
54423722 |
ttgttttgcagcgcatatgatgaagaacttcgaatgctgttagcgcattatccatgattgagcgagaatgcacaaaggctgcctgttcttgggaaatcca |
54423821 |
T |
|
| Q |
120 |
tttgttaattagtggagggagacgattggaaaggaccataaagacaatcttgtataatacattgcagagagaaataggccgaaggtctcgcatggattcc |
219 |
Q |
| |
|
||||||||| |||||| | ||||||||| |||||| || | || ||||||||||| |||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
54423822 |
tttgttaataagtggacgaagacgattgaccaggaccttagaaacgatcttgtataacacattgcagagagaaataggtcgaaggtcccgcatggattcc |
54423921 |
T |
|
| Q |
220 |
ggataatcaccctttg |
235 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
54423922 |
agattatcaccctttg |
54423937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 94 - 223
Target Start/End: Complemental strand, 20121052 - 20120923
Alignment:
| Q |
94 |
aaggctgtttgttcttgggaaatccatttgttaattagtggagggagacgattggaaaggaccataaagacaatcttgtataatacattgcagagagaaa |
193 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||| |||| |||||||||||| ||||||| || ||||||||||||| | |||||| |||||||||| |
|
|
| T |
20121052 |
aaggctgcttgttcttgggaaatccatttgttgattaatggatggagacgattggcaaggaccttagagacaatcttgtacagtacattacagagagaaa |
20120953 |
T |
|
| Q |
194 |
taggccgaaggtctcgcatggattccggat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20120952 |
taggccgaaggtctcgcatggattccggat |
20120923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 91
Target Start/End: Complemental strand, 20127395 - 20127324
Alignment:
| Q |
20 |
ttgttttgtagcgcatatgatggagaactttgaatgatgttagcgcattgtccatgattgagtgagaatgca |
91 |
Q |
| |
|
|||||||| |||||||||||||||| |||| || | ||||||||||| |||||||||||| ||||||||| |
|
|
| T |
20127395 |
ttgttttgcagcgcatatgatggaggacttcaaaagcggttagcgcattatccatgattgagcgagaatgca |
20127324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University