View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_149 (Length: 240)
Name: NF3229_low_149
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_149 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 47116785 - 47116595
Alignment:
| Q |
17 |
agcttggagtggtgtccatctattgtggaaggattggggattcgttcattaacataacatcattgaatgagatgtatgacgtggaaattttctttgtaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47116785 |
agcttggagtggtgtccatctattgtggaaggattggggattcgttcattaacataacatcattgaatgagatgtatgacgtggaacttttctttgtaac |
47116686 |
T |
|
| Q |
117 |
tgtctccccgaactttcagtaattaataccacaattagcacaaataatttctttcattttctctttccttaccagttttccaccaaataat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116685 |
tgtctccccgaactttcagtaattaataccacaattagcacaaataatttctttcattttctctttccttaccagttttccaccaaataat |
47116595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University