View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_157 (Length: 237)
Name: NF3229_low_157
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_157 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 100 - 222
Target Start/End: Complemental strand, 15638874 - 15638754
Alignment:
| Q |
100 |
tttatgctaatatactttgactactaccaattcattcatataaacggatgataaaagataggaagaaacttataaatgcattttcttaa--ttgtttttc |
197 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
15638874 |
tttatgctaatatactttgactactactaattcat----ataaacggatgataaaagacaggaagaaacttataaatgcattttcttaattttttttttc |
15638779 |
T |
 |
| Q |
198 |
aatggattctttgactatcaatcat |
222 |
Q |
| |
|
||||| ||||||||||| ||||||| |
|
|
| T |
15638778 |
aatgggttctttgactaacaatcat |
15638754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University