View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3229_low_157 (Length: 237)

Name: NF3229_low_157
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3229_low_157
NF3229_low_157
[»] chr7 (1 HSPs)
chr7 (100-222)||(15638754-15638874)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 100 - 222
Target Start/End: Complemental strand, 15638874 - 15638754
Alignment:
100 tttatgctaatatactttgactactaccaattcattcatataaacggatgataaaagataggaagaaacttataaatgcattttcttaa--ttgtttttc 197  Q
    ||||||||||||||||||||||||||| |||||||    ||||||||||||||||||| ||||||||||||||||||||||||||||||  || ||||||    
15638874 tttatgctaatatactttgactactactaattcat----ataaacggatgataaaagacaggaagaaacttataaatgcattttcttaattttttttttc 15638779  T
198 aatggattctttgactatcaatcat 222  Q
    ||||| ||||||||||| |||||||    
15638778 aatgggttctttgactaacaatcat 15638754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University