View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_158 (Length: 237)
Name: NF3229_low_158
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_158 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 110 - 221
Target Start/End: Complemental strand, 46971308 - 46971197
Alignment:
| Q |
110 |
atgatgaaattaatctttgtaacatgtacaacatttaatttaacccactccaaaataaactacataaagacttaaaataaatattacacgtatattatac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46971308 |
atgatgaaattaatctttgtaacatgtacaacatttaatttaactcactccaaaatcaactacataaagacttaaaataaatattacacgtatattatac |
46971209 |
T |
 |
| Q |
210 |
accagttataat |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46971208 |
accagttataat |
46971197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 46971403 - 46971358
Alignment:
| Q |
2 |
ccaaaattaaaatgtatgatata-tcaataaactacatgacaaaaa |
46 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46971403 |
ccaaaattaaaatgtatgatataatcaataaactacatgacaaaaa |
46971358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University