View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_163 (Length: 236)
Name: NF3229_low_163
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_163 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 54864335 - 54864541
Alignment:
| Q |
13 |
acagaacatacatagaagattttgtgtactgaaaaacttaatgtggttaattatcccaacttgcttaactattttggtggttatttcttgatcaaaacta |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54864335 |
acagaacatacataga---ttttgtgtactgaaaaacttaatgtggttaattatcccaacttgcttaactattttggtggttatttcttgatcaaaacta |
54864431 |
T |
|
| Q |
113 |
cttgaatttctttgattagaagggtcttttcaaaatcaagactttaatttgggatattttccaagggaatattttacgagaagaagattagaggtactat |
212 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54864432 |
cttgaaattctttgattagaagggtcttttcataatcaagactttaatttgggatattttccaagggaatattttacgagaagaagattagaggtactat |
54864531 |
T |
|
| Q |
213 |
tgtcctcttt |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
54864532 |
tgtcctcttt |
54864541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University