View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_164 (Length: 236)
Name: NF3229_low_164
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_164 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 47002778 - 47002558
Alignment:
| Q |
1 |
atcgagttgttttagacctggttttccattcaatttcttccaaaggggcatgatgattcggtcattgacagcaagagtgagtaggattgcgacgacaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47002778 |
atcgagttgttttagacctggttttccattcaatttcttccaaaggggcatgatgattcggtcattgacagcaagagtgagtaggattgcgacgacaaag |
47002679 |
T |
|
| Q |
101 |
aagactgtaagagatcctgcagggatttgaaaattcccaacattcctttccatggtggcagcttgttcaactgaaaaggttatcatttgtgcatatgtgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47002678 |
aagactgtaagagatcctgcagggatttgaaaattcccaacattcctttccatggtggcggcttgttcaactgaaaaggttatcatttgtgcatatgtgg |
47002579 |
T |
|
| Q |
201 |
tccaaaatataatggttgtgg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47002578 |
tccaaaatataatggttgtgg |
47002558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University