View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_171 (Length: 234)
Name: NF3229_low_171
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_171 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 33046903 - 33047017
Alignment:
| Q |
1 |
aatcaagtttgtataagtggaggaaaatgagggatgtggctttttcaaatgacaagatagtgaagtcaacggttgtgaaaacaagattactgatttactg |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33046903 |
aatcaagtttgtataggtggaggaaaatgagggatgtggctttttcaaatgacaagatagtgaagtcaacgattgtgaaaacaagattactgatttactg |
33047002 |
T |
 |
| Q |
101 |
tgggttttaccgagt |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33047003 |
tgggttttaccgagt |
33047017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 141 - 220
Target Start/End: Original strand, 33047011 - 33047094
Alignment:
| Q |
141 |
accgagtaggattgatatgattaagataagg----aagagttttagtgggtgggatatatgatgtcatattagtatgttatttt |
220 |
Q |
| |
|
||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33047011 |
accgagttagattgatgtgattaagataaggaaggaagagttttagtgggtgggatatatgatgtcatattagtatgttatttt |
33047094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University