View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_174 (Length: 229)
Name: NF3229_low_174
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_174 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 12 - 212
Target Start/End: Complemental strand, 439174 - 438974
Alignment:
| Q |
12 |
gagatgaatggaatgctaaccaactagtgtttgtctttatgggccttatggttttctcgttcatagccgatactcttggcacacatgatgttgttggggc |
111 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
439174 |
gagatgaatgggatgctaaccaactagtttttgtctttatgggccttatggttttctcattcatagccgatactcttggcacacatgatgttgttggggc |
439075 |
T |
 |
| Q |
112 |
ttttttatacgggttgattttacctcacggtaaatttgctgacatggtcgtgtcgatgactaatgattttggtattgggtttcttgcaccgatctacttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
439074 |
ttttttatacgggttgattttacctcacggtaaatttgctgacatggtcgtgtcaatgactaatgattttggtattggctttcttgcaccgatctacttt |
438975 |
T |
 |
| Q |
212 |
t |
212 |
Q |
| |
|
| |
|
|
| T |
438974 |
t |
438974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 12 - 211
Target Start/End: Original strand, 28607729 - 28607928
Alignment:
| Q |
12 |
gagatgaatggaatgctaaccaactagtgtttgtctttatgggccttatggttttctcgttcatagccgatactcttggcacacatgatgttgttggggc |
111 |
Q |
| |
|
||||||||||| ||| ||||||| |||| ||||| | ||||| ||| | |||||||| | |||| | |||| |||||| |||||||| |||||||| || |
|
|
| T |
28607729 |
gagatgaatgggatggtaaccaattagtctttgtggtgatgggactttttgttttctcatacataactgatattcttggtacacatgacgttgttggtgc |
28607828 |
T |
 |
| Q |
112 |
ttttttatacgggttgattttacctcacggtaaatttgctgacatggtcgtgtcgatgactaatgattttggtattgggtttcttgcaccgatctacttt |
211 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||| ||||| || |||||| |
|
|
| T |
28607829 |
atttgtatacgggttgattttacctcacggtaaatttgctgacatggtcacatcaatgactaatgattttggtggtgggtttctagcaccaatttacttt |
28607928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 80 - 153
Target Start/End: Original strand, 13659172 - 13659245
Alignment:
| Q |
80 |
gatactcttggcacacatgatgttgttggggcttttttatacgggttgattttacctcacggtaaatttgctga |
153 |
Q |
| |
|
|||| |||||| ||||| || |||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13659172 |
gatattcttggaacacaagacattgttggggcttttgtgtacgggttgattttacctcacggtaaatttgctga |
13659245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 85 - 184
Target Start/End: Original strand, 13651691 - 13651790
Alignment:
| Q |
85 |
tcttggcacacatgatgttgttggggcttttttatacgggttgattttacctcacggtaaatttgctgacatggtcgtgtcgatgactaatgattttggt |
184 |
Q |
| |
|
|||||||||||| ||| |||| || |||||| | |||||||||||||| ||||| |||||||||||||| |||||| ||| |||||| |||| |||||| |
|
|
| T |
13651691 |
tcttggcacacaagatattgtcggagcttttgtgtacgggttgattttgcctcatggtaaatttgctgatatggtcacgtcaatgactgatgactttggt |
13651790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University