View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_195 (Length: 209)
Name: NF3229_low_195
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_195 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 44001136 - 44000962
Alignment:
| Q |
17 |
cagagaataccgtggcaagagcaaatt-ccaaattattgccttataataacctaaaaagactattgaaggaaattgggcaattgagttgagtctgtgtga |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44001136 |
cagagaataccgtggcaagagcaaatttccaaattattgccgtataataacctaaaaagactattgaaggaaattgggcaattgagttgagtctgtgtga |
44001037 |
T |
 |
| Q |
116 |
cagtagagtttgatacattgctgaaaacagatgaaattgaggaatcccaaagaagtagttcatttgggtcgttta |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
44001036 |
cagtagagtttgatacattgctgaaaacagatgaaattgaggaatcccaaagaagtagttcatctggatcgttta |
44000962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 82 - 190
Target Start/End: Complemental strand, 43991518 - 43991407
Alignment:
| Q |
82 |
aaggaaattgggcaattgagttgagtctgtgtgacagt---agagtttgatacattgctgaaaacagatgaaattgaggaatcccaaagaagtagttcat |
178 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||| | |||||| ||| |||||||||||||||| ||||||||||||||||||| |||| ||||| |
|
|
| T |
43991518 |
aaggaaaatgggcaaatgagttgagtctgtgtgacgctgctagagttggatgcattgctgaaaacagaggaaattgaggaatcccaaaaaagtggttcac |
43991419 |
T |
 |
| Q |
179 |
ttgggtcgttta |
190 |
Q |
| |
|
|| |||||||| |
|
|
| T |
43991418 |
ctgagtcgttta |
43991407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 77 - 169
Target Start/End: Complemental strand, 43997100 - 43997005
Alignment:
| Q |
77 |
tattgaaggaaattgggcaattgagttgagtctgtgtgacagt---agagtttgatacattgctgaaaacagatgaaattgaggaatcccaaagaa |
169 |
Q |
| |
|
|||| |||||||||||||| |||||||| ||||||||||| | |||||| ||| |||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
43997100 |
tattcaaggaaattgggcacttgagttgtgtctgtgtgacgctgctagagttggatgcattgctgaaaacagaggaaattgatgaatcccaaagaa |
43997005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University