View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_196 (Length: 204)
Name: NF3229_low_196
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_196 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 7815989 - 7815837
Alignment:
| Q |
1 |
ttacggttaaaactatcgtatttaattgaaggataacagaaaaagagataggt---aaaggatagctttagaaagagctgaaaaagaaaagcacaagaat |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7815989 |
ttacggttaaaactatcgtatttaattgaaggataacagaaaaagagataggtgaaaaaggatagctttagaaagagctgaaaaagaaaagcacaagaat |
7815890 |
T |
 |
| Q |
98 |
gttcaggcaacaaaagaatatatacaattcttcaaggcagtagcattgaattg |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7815889 |
gttcaggcaacaaaagaatatatacaattcttcaaggcagtagcattgaattg |
7815837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 160 - 204
Target Start/End: Complemental strand, 7815854 - 7815810
Alignment:
| Q |
160 |
ggcagtagcattgaattgacagttaacagtgccagtcaaacaatt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7815854 |
ggcagtagcattgaattgacagttaacagtgccagtcaaaaaatt |
7815810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University