View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_46 (Length: 385)
Name: NF3229_low_46
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_46 |
 | |
|
| [»] scaffold1250 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1250 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: scaffold1250
Description:
Target: scaffold1250; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 1 - 384
Target Start/End: Original strand, 1047 - 1431
Alignment:
| Q |
1 |
agaagtaataacatcaagattgatagtgtcttttttgtaggtaagagtggtcaccaggtgatcataagaactgggtaacgagcacagaaaaataacagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1047 |
agaagtaataacatcaagattgatagtgtcttttttgtaggtaagagtagtcaccaggtgatcataagaactgggtaacgagcacagaaaaataacagcc |
1146 |
T |
|
| Q |
101 |
atatctacgtcatcaattttcaccctcaagcctcaccaaatcagcgactatagtgttgaagacattgacgtgctgttgcaaatcaaa-cattcctgcatc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1147 |
atatctacgtcatcaattttcaccctcaagcctcaccaaatcagcgactatagtgttgaagacattgacgtgctgttgcaaatcaaaccattcctgcatc |
1246 |
T |
|
| Q |
200 |
tgcagactctatagtcgttgtttcgcgaacaatttgttcatcaacgtctttgtcatatagtgactttccaatttatcccaaacctccaggatatgataca |
299 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1247 |
ttcagactgtatagtcgttgtttcgcgaacaatttgttcatcaacgtctttgtcatatagtgactttccaatttatcccaaacctccaggatattataca |
1346 |
T |
|
| Q |
300 |
tgacttcatctaaaacacatagatttatcaatccctcgaccttgtccttcatctgttccctatcggtcttcttcatctcactcga |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||| |||| |
|
|
| T |
1347 |
tgacttcatctaaaacacatagatttatcaatcccgcgaccttgtccttcatctgttccctatcggtcttctccatgtcagtcga |
1431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University