View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_66 (Length: 335)
Name: NF3229_low_66
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 7 - 317
Target Start/End: Complemental strand, 51914800 - 51914490
Alignment:
| Q |
7 |
ggagcagagactttggatcgggattttccggcttacgctactctcggaaacggaaaacgtttctccggcgtttcactttacagtggagaaggaatgggaa |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51914800 |
ggagcagggactttggatcgggattttccggcttacgctactctcggaaacggaaaacgtttctccggcgtttcactttacagtggagaaggaatgggaa |
51914701 |
T |
|
| Q |
107 |
acgaaccggttggtttggtttattttaacgaacggtttaattcatcgagtagtatatgtatgcccggttcacttgactctgaaatcgtgcgcgggaaagt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51914700 |
acgaaccggttggtttggtttattttaacgaacggtttaattcatcgagtagtatatgtatgcccggttcacttgactctgaaatcgtgcgcgggaaagt |
51914601 |
T |
|
| Q |
207 |
ggttgtttgtgataggggtgtaaattcacgtgtggagaaaggcacggttgtgattgacgccggaggtgttgggatgattcttgcaaacacggcggcgagc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51914600 |
ggttgtttgtgataggggtgtaaattcacgtgtggagaaaggcacggttgtgattgacgccggaggtgttgggatgattcttgcaaacacggcggcgagc |
51914501 |
T |
|
| Q |
307 |
ggtgaaggagt |
317 |
Q |
| |
|
||||||||||| |
|
|
| T |
51914500 |
ggtgaaggagt |
51914490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 76 - 134
Target Start/End: Original strand, 18383298 - 18383356
Alignment:
| Q |
76 |
gtttcactttacagtggagaaggaatgggaaacgaaccggttggtttggtttattttaa |
134 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
18383298 |
gtttcactttacagtgggaaaggaatgggaaataaaccggttagtttggtttattttaa |
18383356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University