View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_94 (Length: 287)
Name: NF3229_low_94
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_94 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 152 - 268
Target Start/End: Original strand, 43406951 - 43407067
Alignment:
| Q |
152 |
tagctatgatgagaacataaactaatataaattatcaacaaatataattttacaaagttttttcaatttgatattatatttaaatgtgaaaggaagtaat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43406951 |
tagctatgatgagaacataaactaatataaattatcaacaaatttaattttacaaagttttttcaatttgatattatatttaaatgtgaaaggaagtaat |
43407050 |
T |
 |
| Q |
252 |
aggtagttagggagaca |
268 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43407051 |
aggtagttagggagaca |
43407067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 43406774 - 43406819
Alignment:
| Q |
22 |
cttatttatcgattgttcaacatcgtaattaaattcaaaagagctt |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43406774 |
cttatttatcgattgttcaacatcgtaattaaattcaaaagagctt |
43406819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University