View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3229_low_97 (Length: 284)
Name: NF3229_low_97
Description: NF3229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3229_low_97 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 140 - 265
Target Start/End: Complemental strand, 28823793 - 28823668
Alignment:
| Q |
140 |
atgttttgactatgctagattatgtcgccgcgaactcgatatcatgttgtcacattgcgtccttgatctatgattcttgaagatctgttgaaatatacaa |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28823793 |
atgttttgactatgctagattatgccgccgcgaactcgatatcatgttgtcacattgcgtccttgatctatgattcttgcagatctgttgaaatatacaa |
28823694 |
T |
|
| Q |
240 |
ttttcttgcctttggtttgttgccac |
265 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
28823693 |
ttttcttgcctttggtttgttgccac |
28823668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 13 - 80
Target Start/End: Complemental strand, 28824798 - 28824731
Alignment:
| Q |
13 |
aatatctctaaattaaagtacatataattcacataaactactttcctaagttacagacatgccattaa |
80 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28824798 |
aatatctctaaattaaagtacaaataattcacataaactactttcctaagttacagatatgccattaa |
28824731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 77 - 135
Target Start/End: Complemental strand, 28823880 - 28823822
Alignment:
| Q |
77 |
ttaagacatacatttttctttatgtatgtgcatttagatatgagttttccaatccattt |
135 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28823880 |
ttaagagatacatttttctttatgtttgtgcatttagatatgagttttccaatccattt |
28823822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University